The Piltdown Hoax



           In December of 1912, Charles Dawson presented a skull to the Geological Society of London.  This skull was quite unusual, as although it had many human features, its brain size was 2/3 of the average human brain, and its teeth were similar to a chimpanzee's.  Dawson claimed that the skull was found by a worker in a gravel pit in Piltdown, England, and after conferring with Arthur Smith Woodward, the two had gone down to the pit and retrieved the other remaining pieces of the skull and jaw.  This skull caused an unbelievable fervor within the scientific community, as the structural makeup of the skull had led many scientists to believe that this was definitive evidence of human evolution, with the Piltdown skull providing proof as the "missing link" between apes and human beings.  The find was highly controversial at the time, and a fellow scientist named Arthur Keith recreated the skull without many of the ape-like features.  Keith began to challenge the fact that the teeth of the skull did not correspond to the normal eating motions of a human being, and thus more and more scientists made accusations that the Piltdown skull was constructed of a human skull and chimpanzee teeth, making the find a forgery.  Eventually several scientists including David Waterson, Gerrit Miller, and Marcellin Boule published journals stating that they believed the skull to be a forgery, and that the teeth had been taken from another ape.  However, this evidence was overlooked for decades, and many in the scientific community took the Piltdown skull as fact, and thus many writings related to evolution were shaped by this finding.  Many people used the fact of the smaller brain size of the skull as evidence that the human brain evolved before our teeth and jaw, a theory that is seen as totally inaccurate by the modern scientific community.  The Piltdown skull was finally accepted in 1953 when Time magazine published findings from Joseph Weiner, Kenneth Page Oakley, and Sir Wilfrid Edward Le Gros Clark that the skull was in fact forged from a human skull, an orangutan jaw, and chimpanzee teeth, with the "fossil" being treated with iron solution and chromic acid to look hundreds of thousands of years older than it really was.
        There were many human faults that impacted this entire fiasco.  For one, the whole excitement over the theory of human evolution contributed towards many scientists overlooking many of the obvious signs that this was a hoax, such as the fact that a skull like the Piltdown skull had never been discovered before, and that the teeth were overwhelmingly similar to that of an ape's.  Also, the personal rivalry between Arthur Keith and Arthur Woodward may have contributed towards Woodward's conclusions, as Woodward may have been motivated by his personal pride and a goal to avoid professional embarrassment by Keith's accusations.  Also, because the theory that brain evolution preceded teeth evolution may have contributed to the fact that it took over forty years for the skull to be accepted as a hoax, despite a dearth of evidence that had already existed proving it to be a hoax.
        The positive aspect that proved the skull to be a hoax was the constant review and study of the claims by the rest of the scientific community.  As mentioned earlier, scientists like Arthur Keith had made reconstructions of the skull proving that the teeth were that of an ape's, and not of a human's.  The scientists involved in the Time article came to their conclusion through using microscopes to carefully examine the dental structure of the teeth and jaw bone and comparing them to those of other primates, as well as using chemical analyses to deduce that there was iron and chromic acid used to create the forgery.
         In order to remove the "human factor" from science so that this hoax is never repeated again, the scientific community would have to continue its practice of constant reviewing and testing of findings and other evidence.  It is so easy for people to find some "evidence" proving a theory and to become so excited that they take it as fact.  However, the best part of the scientific community is its skepticism, as things need to be proved tens, if not hundreds, of times in order to sort fact from fiction.  I would like to remove the human factor from science, as science should be totally objective and not subjective, and I want to know that the facts and evidence are what they really are, and not influenced by petty pride or greed.  As a life lesson, this whole episode just makes me realize that I should always be questioning things, and to never take anything at face value.  This is helpful when buying a used car, as one should always test and make sure they're not being duped by an offer that's too good to be true, or when applying to jobs, as some jobs that I've applied to in the past turned out to be scams, and I came close to have been duped by some impostor.   

Comparative Primate Post:
Comparing the diet of the Common chimpanzee, Western hoolock gibbon, olive baboon, Madam Berthe's mouse lemur, and Geoffroy's spider monkey.

Common Chimpanzee:

The common chimpanzee doesn't really have one set environment, as they have been reported as living in swamps, woodlands, rainforests, the savanna, and other areas of Africa, and it seems like there isn't any sort of weather or environmental preference.  However, like most primates, chimpanzees live in trees, and thus are likely to be found in wooded, forest regions.  Due to their varied environmental habits, the diets of chimpanzees mostly consist of fruits, bugs, leaves, and tree bark, as these are all things that are almost universal to most environments, aside from perhaps fruits.  It could be seen as an environmental adaptation, because a species that travels so much and occupies so many varied environments must choose a food source that is easily found all over the world.  Because they live in trees, it is obvious that they would look to leaves and fruits for food sources, as they are in such close proximity.  Chimpanzees are also known to eat other small monkey species, mainly in situations where there aren't enough trees for the prey monkey species to hide.

Western Hoolock Gibbon:


Western hoolock gibbons live almost exclusively in densely wooded forest regions that experience plenty of rainfall, mostly in India and Bangladesh.  This species only eats fruits and leaves, which could clearly be seen as an environmental adaptation, due to the fact that wet, dense forest areas are bound to be lush with fresh fruits and infinite amounts of leaves.  Also, like the chimpanzee, western hoolock gibbons live high up in the trees, and thus leaves and fruits present themselves as easily accessible food sources.

Olive Baboon:


The olive baboon resides all over Africa, yet like the common chimpanzee, this species can be found in a wide variety of environments.  Many olive baboons have been found in rain forests, though the majority of them are found in flat, plain regions and grasslands.  Because of the varied environments in which this species occupies, the olive baboons have been known to eat practically anything, and thus adapt its eating habits to whatever food source is most easily accessible to its current environment.  This species eats everything from fruits and leaves to birds and foxes.  This species is a tremendous example of natural selection, as this species is incredibly abundant and populated, which can be attributed to how easily the olive baboon can adapt to any sort of environment and any sort of diet.

Madam Berthe's Mouse Lemur:


Madam Berthe's mouse lemur is a small, endangered species from in Madagascar.  This species lives exclusively in dense forest regions on the island and makes its home in tree vines.  The species eats mostly insects, some fruits, and lizards.  This species is quite small, and the fact that it lives on the forest floor makes its food choices quite limited.  Thus, Madam Berthe's mouse lemur has to feed on whatever it can get, and due to its environmental habits that means eating the tiny insects that crawl on the trees and forest floor.  The relative lack of fruit in its diet, compared to the other species on this list, is mostly due to the fact that this species doesn't live high in the forest canopy, and thus is far from fruit sources.

Geoffroy's Spider Monkey:


Geoffroy's spider monkey exists in forest all across Central America.  This species lives high up in the forests, though also reside on the floor as well.  This species' diet almost entirely consists of fruit, which it gathers by travelling in groups across the forest.  Because this is a forest-based species and is not restricted to a specific region of its habitat, Geoffroy's spider monkey is able to travel all over and find the fruit that it desires, rather than be stuck eating just leaves and insects.  The species is not much of a predatory species, and thus seems like it acquired its propensity for fruits due to the large availability of fruits in its habitat.

Overall I think that it is interesting reading that most of these primates live in trees and eat fruits, leaves, and insects, as I thought that most primates would eat meat sources.  However, after reading of their environmental habitats, it makes sense why they would choose such plant-based diets.  It is quite interesting to read of species like the common chimpanzee that are able to live in any habitat and eat a huge variety of foods.  When I read that these sorts of species are the biggest and most populated species, it makes tons of sense to me, and only reinforces the evolutionary concepts which I've learned thus far in this class.

Homologous Trait:
Antennae of Shrimp and Centipedes

Shrimp (lysmata debelius)

Centipede (lithobius forficatus)

The shrimp (which in this case is the species lysmata debelius) is an anthropod species that lives in the water.  The centipede (lithobius forficatus) is another anthropod species, except that it exists on land.  Both species possess antennae atop their heads.  The shrimp, however, has two sets of antennae, with the back row of antennae being smaller and called antennules.  Meanwhile the centipede only has the two antennae.  The Shrimp's antennae are longer and thinner, and are meant to help larvae swim, while the centipede's antennae are thicker and stronger and meant to provide sensory information.  These differences are primarily due to the fact that shrimp exist in water and thus need antennae that float better with the water, whereas the centipede lives on land and needs strong antennae.  The common ancestor of both of these species was some sort of anthropod, though I cannot find any more specific information than that.  I know that it had antennae because all anthropods have antennae.

Analogous Traits:
Wings of Blue Jays and Swallowtail Butterflies

Blue Jay

Swallowtail Butterfly

The blue jay is a type of bird, while the swallowtail butterfly is a type of insect.  Both of these species possess the trait of wings.  Both wings take up a large portion of the body of both species and are required for each species to fly in the air.  The fact that both species are able to fly with wings would suggest a similarity between the two species.  However, the two species wings are analogous because their common ancestors did not have wings.  The common ancestor of the bird and butterfly was either a reptile or anthropod, and neither possessed wings.

Post #2

mRNA strand:

GCACTACACCTGATGGGGGTAGAACGGCAAGTGCATCTCAG