Human Variation and Race Blog

Environmental Stress: Cold

1.  The environmental stress of cold weather negatively impacts the survival of human beings through its disruption of homeostasis.  This disruption severely effects the human body because the body is used to being heated to a particular temperature, and severe decreases from this target temperature causes tremendous stress and trauma to the human body.  The cold weather thus makes it much more difficult for the various organ systems of the human body to function properly.

Short Term Adaptation:  An example of a short term adaptation to the cold would be shivering.  Shivering works to temporarily stop one's body from feeling cold by feeling warmer as a result of the constant muscle movement that shivering produces.  However, once a person stops shivering the unpleasant cold feelings return.


Facultative Adaptation:   A facultative adaptation to the cold weather would be the human body's response to urinate as to remove fluids from one's body as to lower the person's temperature.  The reason that this works is because the human body sends blood to the kidneys so that the person's organs will warm up.  With all this blood inside of the kidneys, the organ is forced to expel the urine to make room for the extra blood.


Developmental Adaptation:  A developmental adaptation to the cold would be for people's bodies to store more fat so that their bodies would be able to retain more heat.  The extra layers of fat causes for more heat to be stored inside of a person's body.


Cultural Adaptation: One cultural adaptation that human beings use to adapt to the cold weather is heavy, thick clothing.  Human beings have adapted their clothing styles over thousands of years so that their bodies can be warmed by the thick clothing inside of cold climates.
 


Some benefits to studying the human adaptations to the cold weather would be that anthropologists and scientists can understand the causes for the genetic differences of humans in cold and warm climates, as well as perhaps to understand why people shiver and do random behaviors that some people might not understand the reason for.  This information can be used in a productive way so that people can develop better clothing products to warm people's body and ward off the negative effects of cold weather.  They can also use this information to better understand the human body's response to cold weather so as to develop better insulation products for homes.

I would say that one could study race to compare the adaptative responses of someone of African ancestry, for example, to someone of Eskimo ancestry.  However, simply using one's skin color or race to classify a person is a poor way to classify somebody, because most races originate from a specific environment, and thus the reason a particular race would exhibit certain characterisitics is all due to their environmental stressors.  For example, a group of Asians that has existed for thousands of years in a warm environment would display a different ability to adapt to the cold weather than would a group of Asians who have lived in the cold for thousands of years.

Language Blog

I found this experiment to be tough, mainly because of how awkward it felt trying to have the conversation without using any words or sign language.  It was tough to think of something to have a "conversation" about without using words, and it took us (my brother and I) about six minutes or so before we had a good enough flow in terms of him understanding my expressions for us to have a "conversation".  I noticed that my brother tried to "dumb" down his questions or statements, so that it was much easier for him to gauge my response, such as by asking yes or no questions, or asking about how I felt about things, so that I gave a facial expression corresponding with my feelings.  My brother also messed around with me a little bit, as he joked with me while I couldn't respond to him verbally.  If two cultures met and one could speak verbally but one could not use symbolic language, I would say that the question of "who has the advantage in communicating complex ideas" would be dependent on whether or not the non-symbolic culture could understand the language of the opposite culture.  If they did, then obviously the speaking culture could communicate complex ideas easier.  However, if the speaking culture communicated in a language that the other could not understand, then I would say that the non-symbolic culture would have an advantage, as facial expressions and body language are universally understood symbols, as opposed to a single language which only a portion of the world understands.  I would say that the speaking culture might view the non-symbolic culture as primitive or less intelligent/less advanced, due to their inability to communicate on the same level as the speaking culture.    In terms of the real-world interactions between those who can speak easily and those who have trouble speaking, I think that many times those who speak easier try to "baby-talk" or try and dumb down their speech, much like my brother did in our conversation.  I don't think that those who are doing the "baby talk" are intentionally trying to be condescending, but they most likely feel quite frustrated in the fact that the other person's poor speaking ability makes conversation difficult, and thus feel that "baby talk" is the easiest answer.

I was definitely not able to last the 15 minutes communicating exclusively via speech, as my partner and I couldn't stop laughing due to how awkward it was and how odd it felt.  Obviously the difficult part of this was keeping a totally straight face and using no vocal inflections, as I felt kind of like a robot.  My partner didn't have nearly as much trouble as the first part of the exercise, except sometimes he couldn't understand whether or not I was being sarcastic about things due to the lack of expression in my voice and face.  Going off this, I think that this experiment is a great example of how important things like vocal inflection and facial expressions are in our daily conversations, as well as how important they are in terms of things like sarcasm and jokes that we tell, which occur in practically every conversation.  I think that certain vocal expressions and facial expressions are universal as well.  Clearly people who are blind cannot read body language, and I'm sure that that disability clearly hinders their ability to communicate quite a bit, despite the fact that they can still speak and hear clearly.  The adaptive benefit to reading body language would perhaps be to understand whether or not an animal in the wild was a predator or ready to attack based on whether or not his body language looked aggressive.  Perhaps it also works for mating purposes, so that a person could tell whether or not a perspective mate was conveying feelings of mutual attraction.  I'm not so sure that there are many scenarios where it would be advantageous for someone to be unable to read body language, but I can see many scenarios where it would be advantageous for the opposite person to be unable to read one's own body language.  For example, if a person were going to try and sneak up on somebody and perhaps kill them or try and arrest them, it would be good to not be able to convey one's anxiousness.

The Piltdown Hoax



           In December of 1912, Charles Dawson presented a skull to the Geological Society of London.  This skull was quite unusual, as although it had many human features, its brain size was 2/3 of the average human brain, and its teeth were similar to a chimpanzee's.  Dawson claimed that the skull was found by a worker in a gravel pit in Piltdown, England, and after conferring with Arthur Smith Woodward, the two had gone down to the pit and retrieved the other remaining pieces of the skull and jaw.  This skull caused an unbelievable fervor within the scientific community, as the structural makeup of the skull had led many scientists to believe that this was definitive evidence of human evolution, with the Piltdown skull providing proof as the "missing link" between apes and human beings.  The find was highly controversial at the time, and a fellow scientist named Arthur Keith recreated the skull without many of the ape-like features.  Keith began to challenge the fact that the teeth of the skull did not correspond to the normal eating motions of a human being, and thus more and more scientists made accusations that the Piltdown skull was constructed of a human skull and chimpanzee teeth, making the find a forgery.  Eventually several scientists including David Waterson, Gerrit Miller, and Marcellin Boule published journals stating that they believed the skull to be a forgery, and that the teeth had been taken from another ape.  However, this evidence was overlooked for decades, and many in the scientific community took the Piltdown skull as fact, and thus many writings related to evolution were shaped by this finding.  Many people used the fact of the smaller brain size of the skull as evidence that the human brain evolved before our teeth and jaw, a theory that is seen as totally inaccurate by the modern scientific community.  The Piltdown skull was finally accepted in 1953 when Time magazine published findings from Joseph Weiner, Kenneth Page Oakley, and Sir Wilfrid Edward Le Gros Clark that the skull was in fact forged from a human skull, an orangutan jaw, and chimpanzee teeth, with the "fossil" being treated with iron solution and chromic acid to look hundreds of thousands of years older than it really was.
        There were many human faults that impacted this entire fiasco.  For one, the whole excitement over the theory of human evolution contributed towards many scientists overlooking many of the obvious signs that this was a hoax, such as the fact that a skull like the Piltdown skull had never been discovered before, and that the teeth were overwhelmingly similar to that of an ape's.  Also, the personal rivalry between Arthur Keith and Arthur Woodward may have contributed towards Woodward's conclusions, as Woodward may have been motivated by his personal pride and a goal to avoid professional embarrassment by Keith's accusations.  Also, because the theory that brain evolution preceded teeth evolution may have contributed to the fact that it took over forty years for the skull to be accepted as a hoax, despite a dearth of evidence that had already existed proving it to be a hoax.
        The positive aspect that proved the skull to be a hoax was the constant review and study of the claims by the rest of the scientific community.  As mentioned earlier, scientists like Arthur Keith had made reconstructions of the skull proving that the teeth were that of an ape's, and not of a human's.  The scientists involved in the Time article came to their conclusion through using microscopes to carefully examine the dental structure of the teeth and jaw bone and comparing them to those of other primates, as well as using chemical analyses to deduce that there was iron and chromic acid used to create the forgery.
         In order to remove the "human factor" from science so that this hoax is never repeated again, the scientific community would have to continue its practice of constant reviewing and testing of findings and other evidence.  It is so easy for people to find some "evidence" proving a theory and to become so excited that they take it as fact.  However, the best part of the scientific community is its skepticism, as things need to be proved tens, if not hundreds, of times in order to sort fact from fiction.  I would like to remove the human factor from science, as science should be totally objective and not subjective, and I want to know that the facts and evidence are what they really are, and not influenced by petty pride or greed.  As a life lesson, this whole episode just makes me realize that I should always be questioning things, and to never take anything at face value.  This is helpful when buying a used car, as one should always test and make sure they're not being duped by an offer that's too good to be true, or when applying to jobs, as some jobs that I've applied to in the past turned out to be scams, and I came close to have been duped by some impostor.   

Comparative Primate Post:
Comparing the diet of the Common chimpanzee, Western hoolock gibbon, olive baboon, Madam Berthe's mouse lemur, and Geoffroy's spider monkey.

Common Chimpanzee:

The common chimpanzee doesn't really have one set environment, as they have been reported as living in swamps, woodlands, rainforests, the savanna, and other areas of Africa, and it seems like there isn't any sort of weather or environmental preference.  However, like most primates, chimpanzees live in trees, and thus are likely to be found in wooded, forest regions.  Due to their varied environmental habits, the diets of chimpanzees mostly consist of fruits, bugs, leaves, and tree bark, as these are all things that are almost universal to most environments, aside from perhaps fruits.  It could be seen as an environmental adaptation, because a species that travels so much and occupies so many varied environments must choose a food source that is easily found all over the world.  Because they live in trees, it is obvious that they would look to leaves and fruits for food sources, as they are in such close proximity.  Chimpanzees are also known to eat other small monkey species, mainly in situations where there aren't enough trees for the prey monkey species to hide.

Western Hoolock Gibbon:


Western hoolock gibbons live almost exclusively in densely wooded forest regions that experience plenty of rainfall, mostly in India and Bangladesh.  This species only eats fruits and leaves, which could clearly be seen as an environmental adaptation, due to the fact that wet, dense forest areas are bound to be lush with fresh fruits and infinite amounts of leaves.  Also, like the chimpanzee, western hoolock gibbons live high up in the trees, and thus leaves and fruits present themselves as easily accessible food sources.

Olive Baboon:


The olive baboon resides all over Africa, yet like the common chimpanzee, this species can be found in a wide variety of environments.  Many olive baboons have been found in rain forests, though the majority of them are found in flat, plain regions and grasslands.  Because of the varied environments in which this species occupies, the olive baboons have been known to eat practically anything, and thus adapt its eating habits to whatever food source is most easily accessible to its current environment.  This species eats everything from fruits and leaves to birds and foxes.  This species is a tremendous example of natural selection, as this species is incredibly abundant and populated, which can be attributed to how easily the olive baboon can adapt to any sort of environment and any sort of diet.

Madam Berthe's Mouse Lemur:


Madam Berthe's mouse lemur is a small, endangered species from in Madagascar.  This species lives exclusively in dense forest regions on the island and makes its home in tree vines.  The species eats mostly insects, some fruits, and lizards.  This species is quite small, and the fact that it lives on the forest floor makes its food choices quite limited.  Thus, Madam Berthe's mouse lemur has to feed on whatever it can get, and due to its environmental habits that means eating the tiny insects that crawl on the trees and forest floor.  The relative lack of fruit in its diet, compared to the other species on this list, is mostly due to the fact that this species doesn't live high in the forest canopy, and thus is far from fruit sources.

Geoffroy's Spider Monkey:


Geoffroy's spider monkey exists in forest all across Central America.  This species lives high up in the forests, though also reside on the floor as well.  This species' diet almost entirely consists of fruit, which it gathers by travelling in groups across the forest.  Because this is a forest-based species and is not restricted to a specific region of its habitat, Geoffroy's spider monkey is able to travel all over and find the fruit that it desires, rather than be stuck eating just leaves and insects.  The species is not much of a predatory species, and thus seems like it acquired its propensity for fruits due to the large availability of fruits in its habitat.

Overall I think that it is interesting reading that most of these primates live in trees and eat fruits, leaves, and insects, as I thought that most primates would eat meat sources.  However, after reading of their environmental habitats, it makes sense why they would choose such plant-based diets.  It is quite interesting to read of species like the common chimpanzee that are able to live in any habitat and eat a huge variety of foods.  When I read that these sorts of species are the biggest and most populated species, it makes tons of sense to me, and only reinforces the evolutionary concepts which I've learned thus far in this class.

Homologous Trait:
Antennae of Shrimp and Centipedes

Shrimp (lysmata debelius)

Centipede (lithobius forficatus)

The shrimp (which in this case is the species lysmata debelius) is an anthropod species that lives in the water.  The centipede (lithobius forficatus) is another anthropod species, except that it exists on land.  Both species possess antennae atop their heads.  The shrimp, however, has two sets of antennae, with the back row of antennae being smaller and called antennules.  Meanwhile the centipede only has the two antennae.  The Shrimp's antennae are longer and thinner, and are meant to help larvae swim, while the centipede's antennae are thicker and stronger and meant to provide sensory information.  These differences are primarily due to the fact that shrimp exist in water and thus need antennae that float better with the water, whereas the centipede lives on land and needs strong antennae.  The common ancestor of both of these species was some sort of anthropod, though I cannot find any more specific information than that.  I know that it had antennae because all anthropods have antennae.

Analogous Traits:
Wings of Blue Jays and Swallowtail Butterflies

Blue Jay

Swallowtail Butterfly

The blue jay is a type of bird, while the swallowtail butterfly is a type of insect.  Both of these species possess the trait of wings.  Both wings take up a large portion of the body of both species and are required for each species to fly in the air.  The fact that both species are able to fly with wings would suggest a similarity between the two species.  However, the two species wings are analogous because their common ancestors did not have wings.  The common ancestor of the bird and butterfly was either a reptile or anthropod, and neither possessed wings.

Post #2

mRNA strand:

GCACTACACCTGATGGGGGTAGAACGGCAAGTGCATCTCAG

Jean-Baptiste Lamarck:
source:http://www.ucmp.berkeley.edu/history/lamarck.html

Lamarck was one of the first people to suggest that species could change and alter their physical composition and various other genetic traits over time to fit certain needs.  He believed in the "discredited theory of heredity", which caused him to be poked fun at and mocked by other scientific minds of the time.  However, he was praised for his work as a biologist in studying the invertebrates of insects and mollusks.

• If the environment changes, the traits that are helpful or adaptive to that environment will be 

different

Lamarck totally influenced this thought process, and was one of the first people to discuss this concept in regards to species and evolution.  This idea certainly influenced Darwin, as Lamarck wrote of "many of the same lines of evidence that Darwin was to use in the Origin of Species"  .  Lamarck was a revolutionary thinker for his time, and Darwin certainly must have been influenced by such a outrageous thinker.

I'm sure Darwin could have come to his evolutionary theory without Lamarck, though it certainly would have been far more difficult and perhaps a slightly different theory had Lamarck not existed.  Lamarck's theory of adaptive change is the core of Darwin's beliefs, and I find it hard to believe that Darwin was not significantly influenced by Lamarck's prior work.

The attitude of the church was quite skeptical of Darwin's book On the Origin of Species, and it caused him to publish several editions of the book to respond to the various arguments posed by religious-inspired writers.  Darwin actually included mention of "the creator" in his book, and appeared to still believe in God at the time, which suggested that he believed in some sort of evolutionary/God hybrid theory.